RefSNP Detail For rsnp_sb01000186652    [See in GBrowse]
1.General Information
Reference SNP ID: rsnp_sb01000186652
Version: 1
Chromsome: Chr1
Position: 186652
SNP Class: SNP
2.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
Sobic.001G002200 1618 + T Missense Variant
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ Sobic.001G002200.1 1618 Cgt => Tgt Sobic.001G002200.1 138 Arg=>Cys
3.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb046064513010 Keller T CTGAGTCCCCATCCATTCGCCATCGCTGAC GTTCATATAGGTGTGTTTTCCTCATGAACG 2015-01-01 2015-01-01