SNP Detail For snp_sb008008566430    [See in GBrowse]
1.General Information
SNP ID: snp_sb008008566430
Organism: Sorghum
Individual: IS8525
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: Y
5'flank: CGTTTGGAGGACCAAGAGACTAAGTTGTCG
3'flank: CGAGAAAGACACAGTACCCTGAAGTGGAGC
3.Reference Map information
Chrom Position Reference IS8525
Chr1 125672 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb047064858429 E-Tian Y CGTTTGGAGGACCAAGAGACTAAGTTGTCG CGAGAAAGACACAGTACCCTGAAGTGGAGC 2015-01-01 2015-01-01
snp_sb031033736003 PI586430 Y CGTTTGGAGGACCAAGAGACTAAGTTGTCG CGAGAAAGACACAGTACCCTGAAGTGGAGC 2015-01-01 2015-01-01
snp_sb020021629032 RTx7000 Y CGTTTGGAGGACCAAGAGACTAAGTTGTCG CGAGAAAGACACAGTACCCTGAAGTGGAGC 2015-01-01 2015-01-01
snp_sb043061164519 Zengada (IBC/E-308) Y CGTTTGGAGGACCAAGAGACTAAGTTGTCG CGAGAAAGACACAGTACCCTGAAGTGGAGC 2015-01-01 2015-01-01
snp_sb026028437938 SC237-14E Y CGTTTGGAGGACCAAGAGACTAAGTTGTCG CGAGAAAGACACAGTACCCTGAAGTGGAGC 2015-01-01 2015-01-01
snp_sb022024411836 SC103-14E Y CGTTTGGAGGACCAAGAGACTAAGTTGTCG CGAGAAAGACACAGTACCCTGAAGTGGAGC 2015-01-01 2015-01-01
snp_sb028030306886 SC35C Y CGTTTGGAGGACCAAGAGACTAAGTTGTCG CGAGAAAGACACAGTACCCTGAAGTGGAGC 2015-01-01 2015-01-01
snp_sb009009583227 IS9710 Y CGTTTGGAGGACCAAGAGACTAAGTTGTCG CGAGAAAGACACAGTACCCTGAAGTGGAGC 2015-01-01 2015-01-01
snp_sb033036509636 S. bicolor subsp. verticilliflorum (PI300119) Y CGTTTGGAGGACCAAGAGACTAAGTTGTCG CGAGAAAGACACAGTACCCTGAAGTGGAGC 2015-01-01 2015-01-01
snp_sb034039666932 S. bicolor (PI226096) Y CGTTTGGAGGACCAAGAGACTAAGTTGTCG CGAGAAAGACACAGTACCCTGAAGTGGAGC 2015-01-01 2015-01-01
snp_sb003002890530 B923296 Y CGTTTGGAGGACCAAGAGACTAAGTTGTCG CGAGAAAGACACAGTACCCTGAAGTGGAGC 2015-01-01 2015-01-01
snp_sb001000000015 Ai4 Y CGTTTGGAGGACCAAGAGACTAAGTTGTCG CGAGAAAGACACAGTACCCTGAAGTGGAGC 2015-01-01 2015-01-01
snp_sb025026975412 SC23 Y CGTTTGGAGGACCAAGAGACTAAGTTGTCG CGAGAAAGACACAGTACCCTGAAGTGGAGC 2015-01-01 2015-01-01
snp_sb017018289639 QL12 Y CGTTTGGAGGACCAAGAGACTAAGTTGTCG CGAGAAAGACACAGTACCCTGAAGTGGAGC 2015-01-01 2015-01-01
snp_sb002001235395 BTx642 Y CGTTTGGAGGACCAAGAGACTAAGTTGTCG CGAGAAAGACACAGTACCCTGAAGTGGAGC 2015-01-01 2015-01-01
snp_sb014015000629 Macia Y CGTTTGGAGGACCAAGAGACTAAGTTGTCG CGAGAAAGACACAGTACCCTGAAGTGGAGC 2015-01-01 2015-01-01
snp_sb030032669155 SC62C Y CGTTTGGAGGACCAAGAGACTAAGTTGTCG CGAGAAAGACACAGTACCCTGAAGTGGAGC 2015-01-01 2015-01-01
snp_sb012012806327 LR9198 Y CGTTTGGAGGACCAAGAGACTAAGTTGTCG CGAGAAAGACACAGTACCCTGAAGTGGAGC 2015-01-01 2015-01-01
snp_sb004003591683 Greenleaf Y CGTTTGGAGGACCAAGAGACTAAGTTGTCG CGAGAAAGACACAGTACCCTGAAGTGGAGC 2015-01-01 2015-01-01
snp_sb019020742373 Rio Y CGTTTGGAGGACCAAGAGACTAAGTTGTCG CGAGAAAGACACAGTACCCTGAAGTGGAGC 2015-01-01 2015-01-01
6.Fasta Information
AACGAGAGAC TGTAGTCTGT CGTTTGGAGG ACCAAGAGAC TAAGTTGTCG
Y
CGAGAAAGAC ACAGTACCCT GAAGTGGAGC GCCGAGAGTC GGGACAGCCA