SNP Detail For snp_sb008008566428    [See in GBrowse]
1.General Information
SNP ID: snp_sb008008566428
Organism: Sorghum
Individual: IS8525
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: A
5'flank: CCATACAACATGTATGTAATTATGTATATA
3'flank: GTGTGTGTGTGTGTGCGCGCGCGCACGTGT
3.Reference Map information
Chrom Position Reference IS8525
Chr1 116379 C A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
Sobic.001G001400 329 - A 3' UTR Variant
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
NA NA NA NA NA NA NA
6.Fasta Information
GCTGTGTACT GACAAGGCCA CCATACAACA TGTATGTAAT TATGTATATA
A
GTGTGTGTGT GTGTGCGCGC GCGCACGTGT GTGTGTGTAC ACTAGAAGGA