SNP Detail For snp_sb008008566424    [See in GBrowse]
1.General Information
SNP ID: snp_sb008008566424
Organism: Sorghum
Individual: IS8525
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: Y
5'flank: GTTTTTCTAGATTTTCACCATATATGCACC
3'flank: CTAATAACACAAGTCTATATATCTATGAGC
3.Reference Map information
Chrom Position Reference IS8525
Chr1 557 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
NA NA NA NA NA NA NA
6.Fasta Information
CAAATTTTGT AAAAATAGTG GTTTTTCTAG ATTTTCACCA TATATGCACC
Y
CTAATAACAC AAGTCTATAT ATCTATGAGC CAAATGCACA TCCCTTAATT