SNP Detail For snp_sb048065986110    [See in GBrowse]
1.General Information
SNP ID: snp_sb048065986110
Organism: Sorghum
Individual: SS79
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: A
5'flank: TCTAAACGAATTCGGTCTCGAATACGGTCG
3'flank: AAAATATCCTTACCGTTTTCATCCCTAATG
3.Reference Map information
Chrom Position Reference SS79
Chr6 5934 G A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb008009096682 IS8525 A TCTAAACGAATTCGGTCTCGAATACGGTCG AAAATATCCTTACCGTTTTCATCCCTAATG 2015-01-01 2015-01-01
snp_sb041059544415 Kilo (IBC/E-382) A TCTAAACGAATTCGGTCTCGAATACGGTCG AAAATATCCTTACCGTTTTCATCCCTAATG 2015-01-01 2015-01-01
snp_sb045064248199 Ji_2731 A TCTAAACGAATTCGGTCTCGAATACGGTCG AAAATATCCTTACCGTTTTCATCCCTAATG 2015-01-01 2015-01-01
snp_sb021023634076 S. bicolor subsp. drummondii (PI330272) A TCTAAACGAATTCGGTCTCGAATACGGTCG AAAATATCCTTACCGTTTTCATCCCTAATG 2015-01-01 2015-01-01
snp_sb047065096936 E-Tian A TCTAAACGAATTCGGTCTCGAATACGGTCG AAAATATCCTTACCGTTTTCATCCCTAATG 2015-01-01 2015-01-01
snp_sb035042567395 PI585749 A TCTAAACGAATTCGGTCTCGAATACGGTCG AAAATATCCTTACCGTTTTCATCCCTAATG 2015-01-01 2015-01-01
snp_sb034040684183 S. bicolor (PI226096) A TCTAAACGAATTCGGTCTCGAATACGGTCG AAAATATCCTTACCGTTTTCATCCCTAATG 2015-01-01 2015-01-01
snp_sb040058235843 Yik. solate (IBC/E-339) A TCTAAACGAATTCGGTCTCGAATACGGTCG AAAATATCCTTACCGTTTTCATCCCTAATG 2015-01-01 2015-01-01
snp_sb019021167262 Rio A TCTAAACGAATTCGGTCTCGAATACGGTCG AAAATATCCTTACCGTTTTCATCCCTAATG 2015-01-01 2015-01-01
snp_sb039056775535 IBC/E-38432 A TCTAAACGAATTCGGTCTCGAATACGGTCG AAAATATCCTTACCGTTTTCATCCCTAATG 2015-01-01 2015-01-01
snp_sb025027727160 SC23 A TCTAAACGAATTCGGTCTCGAATACGGTCG AAAATATCCTTACCGTTTTCATCCCTAATG 2015-01-01 2015-01-01
6.Fasta Information
TACGGAGAGA TCTGAACCCT TCTAAACGAA TTCGGTCTCG AATACGGTCG
A
AAAATATCCT TACCGTTTTC ATCCCTAATG GTAGTCATGC TCTAGTACAT