SNP Detail For snp_sb048065986109    [See in GBrowse]
1.General Information
SNP ID: snp_sb048065986109
Organism: Sorghum
Individual: SS79
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: C
5'flank: TCAACGAAACCACACTGCTTTACATAATCA
3'flank: AAAACATATTAATACGATCAATATTAGGCC
3.Reference Map information
Chrom Position Reference SS79
Chr6 5430 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb033038123845 S. bicolor subsp. verticilliflorum (PI300119) C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb043062019312 Zengada (IBC/E-308) C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb005005603856 Early Hegari C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb024026622673 SC170-6-8 C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb006006748014 ICSV745 C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb039056775534 IBC/E-38432 C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb025027727159 SC23 C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb037048374192 S. propinquum 369-1 C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb041059544414 Kilo (IBC/E-382) C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb038053425147 S. propinquum 369-2 C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb004004434326 Greenleaf C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb042060617415 Cherekit (IBC/E-460) C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb002002103807 BTx642 C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb019021167261 Rio C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb030033277977 SC62C C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb008009096681 IS8525 C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb018020041364 R931945-2-2 C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb003003246359 B923296 C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb020022162298 RTx7000 C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb023025692321 SC108C C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb035042567392 PI585749 C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb014015465793 Macia C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb046064688176 Keller C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb010011253447 Karper 669 C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb012013468384 LR9198 C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb026028917207 SC237-14E C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb044063440423 PI563516 C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb007007901704 IS3614-2 C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb028031019115 SC35C C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb021023634075 S. bicolor subsp. drummondii (PI330272) C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb009010128303 IS9710 C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb013014594791 M35-1 C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb022024794883 SC103-14E C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb027029869182 SC326-6 C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb029032149264 SC56-14E Y TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb034040684182 S. bicolor (PI226096) C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb040058235842 Yik. solate (IBC/E-339) C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb036044394078 S. bicolor subsp.verticilliflorum (AusTRCF 317961) C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
snp_sb011012357506 KS115 C TCAACGAAACCACACTGCTTTACATAATCA AAAACATATTAATACGATCAATATTAGGCC 2015-01-01 2015-01-01
6.Fasta Information
CTGGACCGCT GTACTCCAAG TCAACGAAAC CACACTGCTT TACATAATCA
C
AAAACATATT AATACGATCA ATATTAGGCC TACCCAGGAC CAGACTTTTC