SNP Detail For snp_sb048065986108    [See in GBrowse]
1.General Information
SNP ID: snp_sb048065986108
Organism: Sorghum
Individual: SS79
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: G
5'flank: ACGAAATAGGGTGTTAGTTTTAGGATGATT
3'flank: GAATGCATCATAATAAGAATTGGAGCATGG
3.Reference Map information
Chrom Position Reference SS79
Chr6 5216 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb011012357503 KS115 G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb022024794878 SC103-14E G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb037048374186 S. propinquum 369-1 G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb006006748008 ICSV745 G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb039056775532 IBC/E-38432 G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb014015465787 Macia G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb041059544412 Kilo (IBC/E-382) G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb025027727157 SC23 G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb023025692315 SC108C G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb035042567386 PI585749 G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb004004434324 Greenleaf G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb012013468378 LR9198 G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb019021167259 Rio G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb038053425142 S. propinquum 369-2 G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb002002103804 BTx642 G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb043062019310 Zengada (IBC/E-308) G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb024026622667 SC170-6-8 G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb042060617409 Cherekit (IBC/E-460) G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb005005603850 Early Hegari G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb029032149258 SC56-14E G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb008009096680 IS8525 G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb003003246356 B923296 G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb020022162295 RTx7000 G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb026028917201 SC237-14E G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb010011253441 Karper 669 G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb044063440420 PI563516 G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb030033277974 SC62C G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb028031019113 SC35C G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb021023634074 S. bicolor subsp. drummondii (PI330272) G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb009010128300 IS9710 G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb046064688173 Keller G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb034040684180 S. bicolor (PI226096) G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb040058235840 Yik. solate (IBC/E-339) G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb007007901698 IS3614-2 G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb033038123839 S. bicolor subsp. verticilliflorum (PI300119) G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb027029869179 SC326-6 G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb036044394072 S. bicolor subsp.verticilliflorum (AusTRCF 317961) G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb013014594785 M35-1 G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
snp_sb018020041358 R931945-2-2 G ACGAAATAGGGTGTTAGTTTTAGGATGATT GAATGCATCATAATAAGAATTGGAGCATGG 2015-01-01 2015-01-01
6.Fasta Information
ATGACCCACC AATTTTCAAA ACGAAATAGG GTGTTAGTTT TAGGATGATT
G
GAATGCATCA TAATAAGAAT TGGAGCATGG TCACCACGCA ACATAGGTAA