SNP Detail For snp_sb048065986102    [See in GBrowse]
1.General Information
SNP ID: snp_sb048065986102
Organism: Sorghum
Individual: SS79
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: C
5'flank: GAATAACTAGGCTTTTCTTAACATTGTGAA
3'flank: ATCTTTGATTCCTAAACCCTCTTTCTTTAG
3.Reference Map information
Chrom Position Reference SS79
Chr6 3251 G C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb008009096674 IS8525 C GAATAACTAGGCTTTTCTTAACATTGTGAA ATCTTTGATTCCTAAACCCTCTTTCTTTAG 2015-01-01 2015-01-01
6.Fasta Information
TGCAATGTTA TAAGCAGTGT GAATAACTAG GCTTTTCTTA ACATTGTGAA
C
ATCTTTGATT CCTAAACCCT CTTTCTTTAG GTTGACAGAT ATCATCCTAG