SNP Detail For snp_sb047064858514    [See in GBrowse]
1.General Information
SNP ID: snp_sb047064858514
Organism: Sorghum
Individual: E-Tian
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: C
5'flank: GCCGCTCCCTTCCGAGCTTGGAGGCGGCGA
3'flank: GGGCGCGTCCAGAGACTCCCCCGCGACTAC
3.Reference Map information
Chrom Position Reference E-Tian
Chr1 1010740 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
Sobic.001G011700 5367 - C Missense Variant
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- Sobic.001G011700.1 5367 Atc => Gtc Sobic.001G011700.1 20 Ile => Val
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb045063952751 Ji_2731 C GCCGCTCCCTTCCGAGCTTGGAGGCGGCGA GGGCGCGTCCAGAGACTCCCCCGCGACTAC 2015-01-01 2015-01-01
snp_sb048065310021 SS79 C GCCGCTCCCTTCCGAGCTTGGAGGCGGCGA GGGCGCGTCCAGAGACTCCCCCGCGACTAC 2015-01-01 2015-01-01
6.Fasta Information
CGCGCTCGCG GAGACCGAGT GCCGCTCCCT TCCGAGCTTG GAGGCGGCGA
C
GGGCGCGTCC AGAGACTCCC CCGCGACTAC CCCCGGGAAC CGCAGCGCCT