SNP Detail For snp_sb045064397632    [See in GBrowse]
1.General Information
SNP ID: snp_sb045064397632
Organism: Sorghum
Individual: Ji_2731
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: C
5'flank: CTCGATCCAATCCCAGTTCCACTTCTTCTT
3'flank: TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC
3.Reference Map information
Chrom Position Reference Ji_2731
Chr9 3945 A C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb001000925707 Ai4 C CTCGATCCAATCCCAGTTCCACTTCTTCTT TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC 2015-01-01 2015-01-01
snp_sb002002433379 BTx642 C CTCGATCCAATCCCAGTTCCACTTCTTCTT TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC 2015-01-01 2015-01-01
snp_sb043062447807 Zengada (IBC/E-308) C CTCGATCCAATCCCAGTTCCACTTCTTCTT TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC 2015-01-01 2015-01-01
snp_sb009010319861 IS9710 C CTCGATCCAATCCCAGTTCCACTTCTTCTT TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC 2015-01-01 2015-01-01
snp_sb026029133172 SC237-14E C CTCGATCCAATCCCAGTTCCACTTCTTCTT TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC 2015-01-01 2015-01-01
snp_sb011012564854 KS115 C CTCGATCCAATCCCAGTTCCACTTCTTCTT TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC 2015-01-01 2015-01-01
snp_sb018020440958 R931945-2-2 C CTCGATCCAATCCCAGTTCCACTTCTTCTT TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC 2015-01-01 2015-01-01
snp_sb004004820515 Greenleaf C CTCGATCCAATCCCAGTTCCACTTCTTCTT TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC 2015-01-01 2015-01-01
snp_sb020022515196 RTx7000 C CTCGATCCAATCCCAGTTCCACTTCTTCTT TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC 2015-01-01 2015-01-01
snp_sb040058532145 Yik. solate (IBC/E-339) C CTCGATCCAATCCCAGTTCCACTTCTTCTT TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC 2015-01-01 2015-01-01
snp_sb025028081314 SC23 C CTCGATCCAATCCCAGTTCCACTTCTTCTT TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC 2015-01-01 2015-01-01
snp_sb034041275706 S. bicolor (PI226096) M CTCGATCCAATCCCAGTTCCACTTCTTCTT TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC 2015-01-01 2015-01-01
snp_sb035042971934 PI585749 C CTCGATCCAATCCCAGTTCCACTTCTTCTT TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC 2015-01-01 2015-01-01
snp_sb032036336601 B963676 C CTCGATCCAATCCCAGTTCCACTTCTTCTT TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC 2015-01-01 2015-01-01
snp_sb029032414712 SC56-14E C CTCGATCCAATCCCAGTTCCACTTCTTCTT TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC 2015-01-01 2015-01-01
snp_sb039057191857 IBC/E-38432 C CTCGATCCAATCCCAGTTCCACTTCTTCTT TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC 2015-01-01 2015-01-01
snp_sb012013785320 LR9198 M CTCGATCCAATCCCAGTTCCACTTCTTCTT TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC 2015-01-01 2015-01-01
snp_sb048066201193 SS79 C CTCGATCCAATCCCAGTTCCACTTCTTCTT TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC 2015-01-01 2015-01-01
snp_sb028031298625 SC35C C CTCGATCCAATCCCAGTTCCACTTCTTCTT TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC 2015-01-01 2015-01-01
snp_sb008009236850 IS8525 C CTCGATCCAATCCCAGTTCCACTTCTTCTT TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC 2015-01-01 2015-01-01
snp_sb010011528176 Karper 669 C CTCGATCCAATCCCAGTTCCACTTCTTCTT TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC 2015-01-01 2015-01-01
snp_sb021024047921 S. bicolor subsp. drummondii (PI330272) M CTCGATCCAATCCCAGTTCCACTTCTTCTT TTCTTCCTCCTCCCTGGCAGCAGAGGCGGC 2015-01-01 2015-01-01
6.Fasta Information
TGTCGAACCC TAGCTTCCAT CTCGATCCAA TCCCAGTTCC ACTTCTTCTT
C
TTCTTCCTCC TCCCTGGCAG CAGAGGCGGC CGACGTCGAA TGAGTTGAAG