SNP Detail For snp_sb045064397628    [See in GBrowse]
1.General Information
SNP ID: snp_sb045064397628
Organism: Sorghum
Individual: Ji_2731
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: Y
5'flank: TCAAACACCTTATAATTTGAGATGGTAGAA
3'flank: TATAAGGTGCATCGTTTGAGAATGGCAAAT
3.Reference Map information
Chrom Position Reference Ji_2731
Chr9 3707 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb021024047916 S. bicolor subsp. drummondii (PI330272) Y TCAAACACCTTATAATTTGAGATGGTAGAA TATAAGGTGCATCGTTTGAGAATGGCAAAT 2015-01-01 2015-01-01
snp_sb025028081310 SC23 Y TCAAACACCTTATAATTTGAGATGGTAGAA TATAAGGTGCATCGTTTGAGAATGGCAAAT 2015-01-01 2015-01-01
snp_sb043062447802 Zengada (IBC/E-308) Y TCAAACACCTTATAATTTGAGATGGTAGAA TATAAGGTGCATCGTTTGAGAATGGCAAAT 2015-01-01 2015-01-01
snp_sb034041275702 S. bicolor (PI226096) Y TCAAACACCTTATAATTTGAGATGGTAGAA TATAAGGTGCATCGTTTGAGAATGGCAAAT 2015-01-01 2015-01-01
snp_sb035042971930 PI585749 Y TCAAACACCTTATAATTTGAGATGGTAGAA TATAAGGTGCATCGTTTGAGAATGGCAAAT 2015-01-01 2015-01-01
snp_sb039057191853 IBC/E-38432 Y TCAAACACCTTATAATTTGAGATGGTAGAA TATAAGGTGCATCGTTTGAGAATGGCAAAT 2015-01-01 2015-01-01
snp_sb004004820511 Greenleaf Y TCAAACACCTTATAATTTGAGATGGTAGAA TATAAGGTGCATCGTTTGAGAATGGCAAAT 2015-01-01 2015-01-01
snp_sb012013785317 LR9198 Y TCAAACACCTTATAATTTGAGATGGTAGAA TATAAGGTGCATCGTTTGAGAATGGCAAAT 2015-01-01 2015-01-01
snp_sb001000925703 Ai4 Y TCAAACACCTTATAATTTGAGATGGTAGAA TATAAGGTGCATCGTTTGAGAATGGCAAAT 2015-01-01 2015-01-01
snp_sb009010319857 IS9710 T TCAAACACCTTATAATTTGAGATGGTAGAA TATAAGGTGCATCGTTTGAGAATGGCAAAT 2015-01-01 2015-01-01
snp_sb011012564850 KS115 Y TCAAACACCTTATAATTTGAGATGGTAGAA TATAAGGTGCATCGTTTGAGAATGGCAAAT 2015-01-01 2015-01-01
6.Fasta Information
CAAATTTGAT GTCAGAAAAG TCAAACACCT TATAATTTGA GATGGTAGAA
Y
TATAAGGTGC ATCGTTTGAG AATGGCAAAT ATGCGAATCC CATTTGCGCG