SNP Detail For snp_sb045064397625    [See in GBrowse]
1.General Information
SNP ID: snp_sb045064397625
Organism: Sorghum
Individual: Ji_2731
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: R
5'flank: TCTATTGCCACCTCGATCTGCTTGTATCAC
3'flank: CATCTCTGCATGGGGTAATGGGATGGAATG
3.Reference Map information
Chrom Position Reference Ji_2731
Chr9 3602 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb039057191850 IBC/E-38432 R TCTATTGCCACCTCGATCTGCTTGTATCAC CATCTCTGCATGGGGTAATGGGATGGAATG 2015-01-01 2015-01-01
snp_sb008009236847 IS8525 R TCTATTGCCACCTCGATCTGCTTGTATCAC CATCTCTGCATGGGGTAATGGGATGGAATG 2015-01-01 2015-01-01
snp_sb028031298622 SC35C R TCTATTGCCACCTCGATCTGCTTGTATCAC CATCTCTGCATGGGGTAATGGGATGGAATG 2015-01-01 2015-01-01
snp_sb002002433377 BTx642 R TCTATTGCCACCTCGATCTGCTTGTATCAC CATCTCTGCATGGGGTAATGGGATGGAATG 2015-01-01 2015-01-01
snp_sb021024047912 S. bicolor subsp. drummondii (PI330272) R TCTATTGCCACCTCGATCTGCTTGTATCAC CATCTCTGCATGGGGTAATGGGATGGAATG 2015-01-01 2015-01-01
snp_sb034041275699 S. bicolor (PI226096) R TCTATTGCCACCTCGATCTGCTTGTATCAC CATCTCTGCATGGGGTAATGGGATGGAATG 2015-01-01 2015-01-01
snp_sb001000925700 Ai4 R TCTATTGCCACCTCGATCTGCTTGTATCAC CATCTCTGCATGGGGTAATGGGATGGAATG 2015-01-01 2015-01-01
snp_sb043062447795 Zengada (IBC/E-308) R TCTATTGCCACCTCGATCTGCTTGTATCAC CATCTCTGCATGGGGTAATGGGATGGAATG 2015-01-01 2015-01-01
snp_sb011012564847 KS115 R TCTATTGCCACCTCGATCTGCTTGTATCAC CATCTCTGCATGGGGTAATGGGATGGAATG 2015-01-01 2015-01-01
snp_sb012013785314 LR9198 R TCTATTGCCACCTCGATCTGCTTGTATCAC CATCTCTGCATGGGGTAATGGGATGGAATG 2015-01-01 2015-01-01
snp_sb004004820506 Greenleaf R TCTATTGCCACCTCGATCTGCTTGTATCAC CATCTCTGCATGGGGTAATGGGATGGAATG 2015-01-01 2015-01-01
snp_sb025028081307 SC23 R TCTATTGCCACCTCGATCTGCTTGTATCAC CATCTCTGCATGGGGTAATGGGATGGAATG 2015-01-01 2015-01-01
snp_sb035042971927 PI585749 G TCTATTGCCACCTCGATCTGCTTGTATCAC CATCTCTGCATGGGGTAATGGGATGGAATG 2015-01-01 2015-01-01
6.Fasta Information
TGGATTTAGA TACTAATTAA TCTATTGCCA CCTCGATCTG CTTGTATCAC
R
CATCTCTGCA TGGGGTAATG GGATGGAATG ATATAATATA ATCCATCTCA