SNP Detail For snp_sb045064397623    [See in GBrowse]
1.General Information
SNP ID: snp_sb045064397623
Organism: Sorghum
Individual: Ji_2731
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: W
5'flank: TCTCTAGCCCTAGCCCAAGCCTAATCATAA
3'flank: GTTCTTCTCTAGCAATATAAGTAACAAGAC
3.Reference Map information
Chrom Position Reference Ji_2731
Chr9 3463 A W
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb009010319852 IS9710 T TCTCTAGCCCTAGCCCAAGCCTAATCATAA GTTCTTCTCTAGCAATATAAGTAACAAGAC 2015-01-01 2015-01-01
snp_sb012013785312 LR9198 W TCTCTAGCCCTAGCCCAAGCCTAATCATAA GTTCTTCTCTAGCAATATAAGTAACAAGAC 2015-01-01 2015-01-01
snp_sb011012564843 KS115 W TCTCTAGCCCTAGCCCAAGCCTAATCATAA GTTCTTCTCTAGCAATATAAGTAACAAGAC 2015-01-01 2015-01-01
snp_sb025028081304 SC23 W TCTCTAGCCCTAGCCCAAGCCTAATCATAA GTTCTTCTCTAGCAATATAAGTAACAAGAC 2015-01-01 2015-01-01
snp_sb034041275697 S. bicolor (PI226096) W TCTCTAGCCCTAGCCCAAGCCTAATCATAA GTTCTTCTCTAGCAATATAAGTAACAAGAC 2015-01-01 2015-01-01
snp_sb021024047910 S. bicolor subsp. drummondii (PI330272) W TCTCTAGCCCTAGCCCAAGCCTAATCATAA GTTCTTCTCTAGCAATATAAGTAACAAGAC 2015-01-01 2015-01-01
snp_sb043062447792 Zengada (IBC/E-308) W TCTCTAGCCCTAGCCCAAGCCTAATCATAA GTTCTTCTCTAGCAATATAAGTAACAAGAC 2015-01-01 2015-01-01
snp_sb035042971924 PI585749 W TCTCTAGCCCTAGCCCAAGCCTAATCATAA GTTCTTCTCTAGCAATATAAGTAACAAGAC 2015-01-01 2015-01-01
snp_sb001000925698 Ai4 W TCTCTAGCCCTAGCCCAAGCCTAATCATAA GTTCTTCTCTAGCAATATAAGTAACAAGAC 2015-01-01 2015-01-01
snp_sb004004820503 Greenleaf W TCTCTAGCCCTAGCCCAAGCCTAATCATAA GTTCTTCTCTAGCAATATAAGTAACAAGAC 2015-01-01 2015-01-01
snp_sb039057191847 IBC/E-38432 W TCTCTAGCCCTAGCCCAAGCCTAATCATAA GTTCTTCTCTAGCAATATAAGTAACAAGAC 2015-01-01 2015-01-01
6.Fasta Information
GGTCGAGGAA GAAGGAAATG TCTCTAGCCC TAGCCCAAGC CTAATCATAA
W
GTTCTTCTCT AGCAATATAA GTAACAAGAC TTGAGAAAAA AATAGGAGAA