SNP Detail For snp_sb045064281254    [See in GBrowse]
1.General Information
SNP ID: snp_sb045064281254
Organism: Sorghum
Individual: Ji_2731
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: T
5'flank: ACTGCATGTACCAAGGTTTGTTCATCCTTA
3'flank: ATTCACACACACATCTTAATGCAGATTCGC
3.Reference Map information
Chrom Position Reference Ji_2731
Chr6 40267184 G T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
Sobic.006G057900 229 + T 5' UTR Premature Start Codon Gain Variant
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb035042706671 PI585749 T ACTGCATGTACCAAGGTTTGTTCATCCTTA ATTCACACACACATCTTAATGCAGATTCGC 2015-01-01 2015-01-01
snp_sb039056884964 IBC/E-38432 T ACTGCATGTACCAAGGTTTGTTCATCCTTA ATTCACACACACATCTTAATGCAGATTCGC 2015-01-01 2015-01-01
snp_sb034040833285 S. bicolor (PI226096) T ACTGCATGTACCAAGGTTTGTTCATCCTTA ATTCACACACACATCTTAATGCAGATTCGC 2015-01-01 2015-01-01
snp_sb002002140235 BTx642 T ACTGCATGTACCAAGGTTTGTTCATCCTTA ATTCACACACACATCTTAATGCAGATTCGC 2015-01-01 2015-01-01
snp_sb023025721571 SC108C T ACTGCATGTACCAAGGTTTGTTCATCCTTA ATTCACACACACATCTTAATGCAGATTCGC 2015-01-01 2015-01-01
snp_sb032036226084 B963676 T ACTGCATGTACCAAGGTTTGTTCATCCTTA ATTCACACACACATCTTAATGCAGATTCGC 2015-01-01 2015-01-01
snp_sb003003259356 B923296 T ACTGCATGTACCAAGGTTTGTTCATCCTTA ATTCACACACACATCTTAATGCAGATTCGC 2015-01-01 2015-01-01
snp_sb025027839557 SC23 T ACTGCATGTACCAAGGTTTGTTCATCCTTA ATTCACACACACATCTTAATGCAGATTCGC 2015-01-01 2015-01-01
snp_sb012013502817 LR9198 T ACTGCATGTACCAAGGTTTGTTCATCCTTA ATTCACACACACATCTTAATGCAGATTCGC 2015-01-01 2015-01-01
snp_sb001000687322 Ai4 T ACTGCATGTACCAAGGTTTGTTCATCCTTA ATTCACACACACATCTTAATGCAGATTCGC 2015-01-01 2015-01-01
snp_sb042060721261 Cherekit (IBC/E-460) C ACTGCATGTACCAAGGTTTGTTCATCCTTA ATTCACACACACATCTTAATGCAGATTCGC 2015-01-01 2015-01-01
snp_sb026028943468 SC237-14E T ACTGCATGTACCAAGGTTTGTTCATCCTTA ATTCACACACACATCTTAATGCAGATTCGC 2015-01-01 2015-01-01
snp_sb028031046287 SC35C T ACTGCATGTACCAAGGTTTGTTCATCCTTA ATTCACACACACATCTTAATGCAGATTCGC 2015-01-01 2015-01-01
snp_sb040058325998 Yik. solate (IBC/E-339) T ACTGCATGTACCAAGGTTTGTTCATCCTTA ATTCACACACACATCTTAATGCAGATTCGC 2015-01-01 2015-01-01
snp_sb014015491892 Macia T ACTGCATGTACCAAGGTTTGTTCATCCTTA ATTCACACACACATCTTAATGCAGATTCGC 2015-01-01 2015-01-01
snp_sb004004545564 Greenleaf T ACTGCATGTACCAAGGTTTGTTCATCCTTA ATTCACACACACATCTTAATGCAGATTCGC 2015-01-01 2015-01-01
snp_sb011012379013 KS115 T ACTGCATGTACCAAGGTTTGTTCATCCTTA ATTCACACACACATCTTAATGCAGATTCGC 2015-01-01 2015-01-01
snp_sb029032181618 SC56-14E T ACTGCATGTACCAAGGTTTGTTCATCCTTA ATTCACACACACATCTTAATGCAGATTCGC 2015-01-01 2015-01-01
snp_sb005005709100 Early Hegari C ACTGCATGTACCAAGGTTTGTTCATCCTTA ATTCACACACACATCTTAATGCAGATTCGC 2015-01-01 2015-01-01
snp_sb047065127994 E-Tian T ACTGCATGTACCAAGGTTTGTTCATCCTTA ATTCACACACACATCTTAATGCAGATTCGC 2015-01-01 2015-01-01
snp_sb022024824327 SC103-14E T ACTGCATGTACCAAGGTTTGTTCATCCTTA ATTCACACACACATCTTAATGCAGATTCGC 2015-01-01 2015-01-01
snp_sb043062139210 Zengada (IBC/E-308) T ACTGCATGTACCAAGGTTTGTTCATCCTTA ATTCACACACACATCTTAATGCAGATTCGC 2015-01-01 2015-01-01
6.Fasta Information
CGTCAGTGCC CTTCTTCGTC ACTGCATGTA CCAAGGTTTG TTCATCCTTA
T
ATTCACACAC ACATCTTAAT GCAGATTCGC TTTGAGATGT GTGCTACACT