SNP Detail For snp_sb045063965161    [See in GBrowse]
1.General Information
SNP ID: snp_sb045063965161
Organism: Sorghum
Individual: Ji_2731
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: G
5'flank: CCATCTCTCCAGGTGCACCTCTGCTTTCTT
3'flank: AATAGTTACTGTTGCGCCACTGTGTCTACG
3.Reference Map information
Chrom Position Reference Ji_2731
Chr1 13355486 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
Sobic.001G162300 931 - G Stop Lost
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- Sobic.001G162300.2 931 Taa => Caa Sobic.001G162300.2 306 * => Gln
- Sobic.001G162300.1 931 Taa => Caa Sobic.001G162300.1 431 * => Gln
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb038050759751 S. propinquum 369-2 G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb002001253905 BTx642 G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb035041779646 PI585749 G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb005005220106 Early Hegari G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb017018292241 QL12 G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb026028458164 SC237-14E G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb029031639019 SC56-14E G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb044062859382 PI563516 G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb007007186784 IS3614-2 G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb011011821561 KS115 G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb046064519317 Keller G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb016016250297 PI525695 G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb036043336283 S. bicolor subsp.verticilliflorum (AusTRCF 317961) G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb022024431355 SC103-14E G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb023025295506 SC108C G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb037045565603 S. propinquum 369-1 G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb012012816410 LR9198 G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb025027001286 SC23 G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb031033773848 PI586430 G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb014015015033 Macia G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb021022846784 S. bicolor subsp. drummondii (PI330272) G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb039055828751 IBC/E-38432 G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb034039702976 S. bicolor (PI226096) G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb043061194232 Zengada (IBC/E-308) G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb013014134073 M35-1 G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb028030330913 SC35C G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb042060190823 Cherekit (IBC/E-460) G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb020021631608 RTx7000 G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb018019411035 R931945-2-2 G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb024026088502 SC170-6-8 G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb033036575319 S. bicolor subsp. verticilliflorum (PI300119) G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
snp_sb009009602028 IS9710 G CCATCTCTCCAGGTGCACCTCTGCTTTCTT AATAGTTACTGTTGCGCCACTGTGTCTACG 2015-01-01 2015-01-01
6.Fasta Information
AGTCCCAATT ATCTCCACAG CCATCTCTCC AGGTGCACCT CTGCTTTCTT
G
AATAGTTACT GTTGCGCCAC TGTGTCTACG GATATAACTG ATACTAGCAC