SNP Detail For snp_sb035042971924    [See in GBrowse]
1.General Information
SNP ID: snp_sb035042971924
Organism: Sorghum
Individual: PI585749
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: W
3.Reference Map information
Chrom Position Reference PI585749
Chr9 3463 A W
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb021024047910 S. bicolor subsp. drummondii (PI330272) W TCTCTAGCCCTAGCCCAAGCCTAATCATAA GTTCTTCTCTAGCAATATAAGTAACAAGAC 2015-01-01 2015-01-01
6.Fasta Information