SNP Detail For snp_sb031034782956    [See in GBrowse]
1.General Information
SNP ID: snp_sb031034782956
Organism: Sorghum
Individual: PI586430
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: Y
5'flank: CAAGGGACCCCCCTAGATCAGACCACATCA
3'flank: ATCATATTCTCTCAACGCAAATCAATACAA
3.Reference Map information
Chrom Position Reference PI586430
Chr6 421 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb016017253841 PI525695 Y CAAGGGACCCCCCTAGATCAGACCACATCA ATCATATTCTCTCAACGCAAATCAATACAA 2015-01-01 2015-01-01
6.Fasta Information
CCAGACTATA TAAGGAGGGG CAAGGGACCC CCCTAGATCA GACCACATCA
Y
ATCATATTCT CTCAACGCAA ATCAATACAA CCAGACGCAG GATGTAGGTA