SNP Detail For snp_sb003003356804    [See in GBrowse]
1.General Information
SNP ID: snp_sb003003356804
Organism: Sorghum
Individual: B923296
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: G
5'flank: CAGGGATCAGGGTTCAGGGATCAGGGTTCA
3'flank: GGATCAGGGTTCAGGGTTCAGGGTTCATGG
3.Reference Map information
Chrom Position Reference B923296
Chr9 6981 C G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb010011528185 Karper 669 G CAGGGATCAGGGTTCAGGGATCAGGGTTCA GGATCAGGGTTCAGGGTTCAGGGTTCATGG 2015-01-01 2015-01-01
snp_sb013014802315 M35-1 G CAGGGATCAGGGTTCAGGGATCAGGGTTCA GGATCAGGGTTCAGGGTTCAGGGTTCATGG 2015-01-01 2015-01-01
snp_sb018020440973 R931945-2-2 S CAGGGATCAGGGTTCAGGGATCAGGGTTCA GGATCAGGGTTCAGGGTTCAGGGTTCATGG 2015-01-01 2015-01-01
snp_sb008009236864 IS8525 G CAGGGATCAGGGTTCAGGGATCAGGGTTCA GGATCAGGGTTCAGGGTTCAGGGTTCATGG 2015-01-01 2015-01-01
snp_sb020022515211 RTx7000 G CAGGGATCAGGGTTCAGGGATCAGGGTTCA GGATCAGGGTTCAGGGTTCAGGGTTCATGG 2015-01-01 2015-01-01
snp_sb032036336613 B963676 G CAGGGATCAGGGTTCAGGGATCAGGGTTCA GGATCAGGGTTCAGGGTTCAGGGTTCATGG 2015-01-01 2015-01-01
snp_sb048066201213 SS79 G CAGGGATCAGGGTTCAGGGATCAGGGTTCA GGATCAGGGTTCAGGGTTCAGGGTTCATGG 2015-01-01 2015-01-01
6.Fasta Information
AGGGATCAGG ATTCAGGGTT CAGGGATCAG GGTTCAGGGA TCAGGGTTCA
G
GGATCAGGGT TCAGGGTTCA GGGTTCATGG TTCAGGGTTC ATGGTTCAGG