SNP Detail For snp_sb003003356802    [See in GBrowse]
1.General Information
SNP ID: snp_sb003003356802
Organism: Sorghum
Individual: B923296
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: T
5'flank: GGGAAACACCCAAGAGTAACAAGAAATCCG
3'flank: AGCAAACTCAAGAATCAAGTGCCACTAAAT
3.Reference Map information
Chrom Position Reference B923296
Chr9 5564 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb048066201202 SS79 T GGGAAACACCCAAGAGTAACAAGAAATCCG AGCAAACTCAAGAATCAAGTGCCACTAAAT 2015-01-01 2015-01-01
snp_sb018020440966 R931945-2-2 T GGGAAACACCCAAGAGTAACAAGAAATCCG AGCAAACTCAAGAATCAAGTGCCACTAAAT 2015-01-01 2015-01-01
snp_sb020022515204 RTx7000 T GGGAAACACCCAAGAGTAACAAGAAATCCG AGCAAACTCAAGAATCAAGTGCCACTAAAT 2015-01-01 2015-01-01
snp_sb008009236858 IS8525 T GGGAAACACCCAAGAGTAACAAGAAATCCG AGCAAACTCAAGAATCAAGTGCCACTAAAT 2015-01-01 2015-01-01
snp_sb034041275731 S. bicolor (PI226096) T GGGAAACACCCAAGAGTAACAAGAAATCCG AGCAAACTCAAGAATCAAGTGCCACTAAAT 2015-01-01 2015-01-01
snp_sb006006942497 ICSV745 T GGGAAACACCCAAGAGTAACAAGAAATCCG AGCAAACTCAAGAATCAAGTGCCACTAAAT 2015-01-01 2015-01-01
snp_sb013014802313 M35-1 T GGGAAACACCCAAGAGTAACAAGAAATCCG AGCAAACTCAAGAATCAAGTGCCACTAAAT 2015-01-01 2015-01-01
snp_sb010011528182 Karper 669 T GGGAAACACCCAAGAGTAACAAGAAATCCG AGCAAACTCAAGAATCAAGTGCCACTAAAT 2015-01-01 2015-01-01
snp_sb032036336608 B963676 T GGGAAACACCCAAGAGTAACAAGAAATCCG AGCAAACTCAAGAATCAAGTGCCACTAAAT 2015-01-01 2015-01-01
6.Fasta Information
TCCAAGTCGT CTAGGGCATC GGGAAACACC CAAGAGTAAC AAGAAATCCG
T
AGCAAACTCA AGAATCAAGT GCCACTAAAT GCAACTCTCA AAGCAATGCA