SNP Detail For snp_sb003003356798    [See in GBrowse]
1.General Information
SNP ID: snp_sb003003356798
Organism: Sorghum
Individual: B923296
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: G
5'flank: CTGCATGGGGTAATGGGATGGAATGATATA
3'flank: TATAATCCATCTCATTCACAAATTTGATGT
3.Reference Map information
Chrom Position Reference B923296
Chr9 3638 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb010011528174 Karper 669 G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb034041275700 S. bicolor (PI226096) G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb039057191851 IBC/E-38432 G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb022025024504 SC103-14E G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb002002433378 BTx642 G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb021024047913 S. bicolor subsp. drummondii (PI330272) R CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb001000925701 Ai4 G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb018020440956 R931945-2-2 G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb040058532144 Yik. solate (IBC/E-339) G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb043062447797 Zengada (IBC/E-308) G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb011012564848 KS115 G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb026029133171 SC237-14E G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb004004820509 Greenleaf G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb048066201191 SS79 G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb035042971928 PI585749 G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb029032414711 SC56-14E G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb013014802307 M35-1 G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb028031298623 SC35C G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb045064397626 Ji_2731 G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb020022515194 RTx7000 G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb025028081308 SC23 G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb012013785315 LR9198 R CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb009010319855 IS9710 G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb006006942490 ICSV745 G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb008009236848 IS8525 G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
snp_sb032036336599 B963676 G CTGCATGGGGTAATGGGATGGAATGATATA TATAATCCATCTCATTCACAAATTTGATGT 2015-01-01 2015-01-01
6.Fasta Information
TCTGCTTGTA TCACACATCT CTGCATGGGG TAATGGGATG GAATGATATA
G
TATAATCCAT CTCATTCACA AATTTGATGT CAGAAAAGTC AAACACCTTA