SNP Detail For snp_sb003003356797    [See in GBrowse]
1.General Information
SNP ID: snp_sb003003356797
Organism: Sorghum
Individual: B923296
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: C
5'flank: TAGAGGTCCAGCAAGTCGGACCCGACGAGC
3'flank: CGAAGAAGAAGTTGAGTGCCCAAGTCACGA
3.Reference Map information
Chrom Position Reference B923296
Chr9 1696 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb020022515191 RTx7000 C TAGAGGTCCAGCAAGTCGGACCCGACGAGC CGAAGAAGAAGTTGAGTGCCCAAGTCACGA 2015-01-01 2015-01-01
snp_sb026029133165 SC237-14E C TAGAGGTCCAGCAAGTCGGACCCGACGAGC CGAAGAAGAAGTTGAGTGCCCAAGTCACGA 2015-01-01 2015-01-01
snp_sb048066201185 SS79 C TAGAGGTCCAGCAAGTCGGACCCGACGAGC CGAAGAAGAAGTTGAGTGCCCAAGTCACGA 2015-01-01 2015-01-01
snp_sb002002433372 BTx642 C TAGAGGTCCAGCAAGTCGGACCCGACGAGC CGAAGAAGAAGTTGAGTGCCCAAGTCACGA 2015-01-01 2015-01-01
snp_sb025028081285 SC23 C TAGAGGTCCAGCAAGTCGGACCCGACGAGC CGAAGAAGAAGTTGAGTGCCCAAGTCACGA 2015-01-01 2015-01-01
snp_sb034041275678 S. bicolor (PI226096) C TAGAGGTCCAGCAAGTCGGACCCGACGAGC CGAAGAAGAAGTTGAGTGCCCAAGTCACGA 2015-01-01 2015-01-01
snp_sb018020440953 R931945-2-2 C TAGAGGTCCAGCAAGTCGGACCCGACGAGC CGAAGAAGAAGTTGAGTGCCCAAGTCACGA 2015-01-01 2015-01-01
snp_sb022025024498 SC103-14E C TAGAGGTCCAGCAAGTCGGACCCGACGAGC CGAAGAAGAAGTTGAGTGCCCAAGTCACGA 2015-01-01 2015-01-01
snp_sb029032414705 SC56-14E C TAGAGGTCCAGCAAGTCGGACCCGACGAGC CGAAGAAGAAGTTGAGTGCCCAAGTCACGA 2015-01-01 2015-01-01
6.Fasta Information
CCAGGAAGGC AGTCAGGAGG TAGAGGTCCA GCAAGTCGGA CCCGACGAGC
C
CGAAGAAGAA GTTGAGTGCC CAAGTCACGA GCCAGCCTCA TTCGTGAAAG