SNP Detail For snp_sb003003356795    [See in GBrowse]
1.General Information
SNP ID: snp_sb003003356795
Organism: Sorghum
Individual: B923296
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: A
5'flank: CTGTGACACCTCAAAATTTCATGACTCCAA
3'flank: AACCCTAAACCCTAAAACCCTAAAACCCTA
3.Reference Map information
Chrom Position Reference B923296
Chr9 70 G A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb033038938574 S. bicolor subsp. verticilliflorum (PI300119) R CTGTGACACCTCAAAATTTCATGACTCCAA AACCCTAAACCCTAAAACCCTAAAACCCTA 2015-01-01 2015-01-01
6.Fasta Information
TCACAGCTAT AGGGCCATGT CTGTGACACC TCAAAATTTC ATGACTCCAA
A
AACCCTAAAC CCTAAAACCC TAAAACCCTA AACCCTAAAC CCTAAACCCT