SNP Detail For snp_sb002002573556    [See in GBrowse]
1.General Information
SNP ID: snp_sb002002573556
Organism: Sorghum
Individual: BTx642
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: C
5'flank: ATTTGCAAGTTTGTAGTAACTCCGTCTGTG
3'flank: CAGCTAAGGACCGATCGTTGTACGTTCTCT
3.Reference Map information
Chrom Position Reference BTx642
Chr10 1854 G C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb035043097447 PI585749 C ATTTGCAAGTTTGTAGTAACTCCGTCTGTG CAGCTAAGGACCGATCGTTGTACGTTCTCT 2015-01-01 2015-01-01
snp_sb025028197808 SC23 C ATTTGCAAGTTTGTAGTAACTCCGTCTGTG CAGCTAAGGACCGATCGTTGTACGTTCTCT 2015-01-01 2015-01-01
6.Fasta Information
TTGACTTAAG CCGGGCGGAG ATTTGCAAGT TTGTAGTAAC TCCGTCTGTG
C
CAGCTAAGGA CCGATCGTTG TACGTTCTCT TGTCATGTTG AACGCATGCC