SNP Detail For snp_sb017019080430    [See in GBrowse]
1.General Information
SNP ID: snp_sb017019080430
Organism: Sorghum
Individual: QL12
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: T
5'flank: AAACTGCGATGATCAAGAGACTTGTGATAA
3'flank: TTTTTGAATATACTTCAGCCCAAACTTTAT
3.Reference Map information
Chrom Position Reference QL12
Chr9 13261 A T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
Sobic.009G000100 3454 - T Missense Variant
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- Sobic.009G000100.1 3454 aTt => aAt Sobic.009G000100.1 626 Ile => Asn
- Sobic.009G000100.2 3454 aTt => aAt Sobic.009G000100.2 621 Ile => Asn
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb028031298652 SC35C T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb044063640719 PI563516 T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb041059865303 Kilo (IBC/E-382) T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb031035326099 PI586430 T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb033038938589 S. bicolor subsp. verticilliflorum (PI300119) T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb004004820568 Greenleaf T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb027030076510 SC326-6 T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb007008254760 IS3614-2 T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb030033472427 SC62C T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb018020440992 R931945-2-2 T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb008009236884 IS8525 T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb034041275757 S. bicolor (PI226096) T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb043062447841 Zengada (IBC/E-308) T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb032036336631 B963676 T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb006006942519 ICSV745 T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb002002433412 BTx642 T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb009010319871 IS9710 T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb010011528204 Karper 669 T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb036044925006 S. bicolor subsp.verticilliflorum (AusTRCF 317961) T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb025028081352 SC23 T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb035042971947 PI585749 T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb003003356822 B923296 T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb016017826101 PI525695 T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb048066201240 SS79 T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb019021313003 Rio T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb039057191878 IBC/E-38432 T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb020022515233 RTx7000 T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb037049831552 S. propinquum 369-1 T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb038054763769 S. propinquum 369-2 T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb013014802335 M35-1 T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
snp_sb001000925745 Ai4 T AAACTGCGATGATCAAGAGACTTGTGATAA TTTTTGAATATACTTCAGCCCAAACTTTAT 2015-01-01 2015-01-01
6.Fasta Information
TGTCTTGTTG TTTGAAATAG AAACTGCGAT GATCAAGAGA CTTGTGATAA
T
TTTTTGAATA TACTTCAGCC CAAACTTTAT TAAAATCTGA CTGGCACCTT