SNP Detail For snp_sb017019080429    [See in GBrowse]
1.General Information
SNP ID: snp_sb017019080429
Organism: Sorghum
Individual: QL12
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: A
5'flank: AGTGGCCACCTATTCCCAGCAGCAATAGCA
3'flank: GTAGCACATCATCCCCTTTCCTATTCTTCT
3.Reference Map information
Chrom Position Reference QL12
Chr9 13047 G A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
Sobic.009G000100 3240 - A Missense Variant
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- Sobic.009G000100.1 3240 cCt => cTt Sobic.009G000100.1 670 Pro => Leu
- Sobic.009G000100.2 3240 cCt => cTt Sobic.009G000100.2 665 Pro => Leu
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb036044925004 S. bicolor subsp.verticilliflorum (AusTRCF 317961) A AGTGGCCACCTATTCCCAGCAGCAATAGCA GTAGCACATCATCCCCTTTCCTATTCTTCT 2015-01-01 2015-01-01
snp_sb009010319870 IS9710 A AGTGGCCACCTATTCCCAGCAGCAATAGCA GTAGCACATCATCCCCTTTCCTATTCTTCT 2015-01-01 2015-01-01
snp_sb016017826100 PI525695 A AGTGGCCACCTATTCCCAGCAGCAATAGCA GTAGCACATCATCCCCTTTCCTATTCTTCT 2015-01-01 2015-01-01
snp_sb035042971946 PI585749 A AGTGGCCACCTATTCCCAGCAGCAATAGCA GTAGCACATCATCCCCTTTCCTATTCTTCT 2015-01-01 2015-01-01
snp_sb044063640718 PI563516 A AGTGGCCACCTATTCCCAGCAGCAATAGCA GTAGCACATCATCCCCTTTCCTATTCTTCT 2015-01-01 2015-01-01
snp_sb037049831550 S. propinquum 369-1 A AGTGGCCACCTATTCCCAGCAGCAATAGCA GTAGCACATCATCCCCTTTCCTATTCTTCT 2015-01-01 2015-01-01
snp_sb041059865302 Kilo (IBC/E-382) A AGTGGCCACCTATTCCCAGCAGCAATAGCA GTAGCACATCATCCCCTTTCCTATTCTTCT 2015-01-01 2015-01-01
snp_sb031035326098 PI586430 A AGTGGCCACCTATTCCCAGCAGCAATAGCA GTAGCACATCATCCCCTTTCCTATTCTTCT 2015-01-01 2015-01-01
snp_sb033038938587 S. bicolor subsp. verticilliflorum (PI300119) A AGTGGCCACCTATTCCCAGCAGCAATAGCA GTAGCACATCATCCCCTTTCCTATTCTTCT 2015-01-01 2015-01-01
snp_sb019021313002 Rio A AGTGGCCACCTATTCCCAGCAGCAATAGCA GTAGCACATCATCCCCTTTCCTATTCTTCT 2015-01-01 2015-01-01
snp_sb030033472426 SC62C A AGTGGCCACCTATTCCCAGCAGCAATAGCA GTAGCACATCATCCCCTTTCCTATTCTTCT 2015-01-01 2015-01-01
snp_sb038054763767 S. propinquum 369-2 A AGTGGCCACCTATTCCCAGCAGCAATAGCA GTAGCACATCATCCCCTTTCCTATTCTTCT 2015-01-01 2015-01-01
snp_sb027030076509 SC326-6 A AGTGGCCACCTATTCCCAGCAGCAATAGCA GTAGCACATCATCCCCTTTCCTATTCTTCT 2015-01-01 2015-01-01
snp_sb007008254759 IS3614-2 A AGTGGCCACCTATTCCCAGCAGCAATAGCA GTAGCACATCATCCCCTTTCCTATTCTTCT 2015-01-01 2015-01-01
6.Fasta Information
CAAATGACAT GTTGGGAACT AGTGGCCACC TATTCCCAGC AGCAATAGCA
A
GTAGCACATC ATCCCCTTTC CTATTCTTCT CACTGATTTC TTTAATCTGA