SNP Detail For snp_sb017019080428    [See in GBrowse]
1.General Information
SNP ID: snp_sb017019080428
Organism: Sorghum
Individual: QL12
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: C
5'flank: ATGAGGCTCCCACCTGTACATACCACAAGA
3'flank: CCTACAGCCTGAAGAGATATGAAACTATTG
3.Reference Map information
Chrom Position Reference QL12
Chr9 10234 A C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
Sobic.009G000100 427 - C 3' UTR Variant
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb033038938583 S. bicolor subsp. verticilliflorum (PI300119) C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb045064397651 Ji_2731 C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb044063640717 PI563516 C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb028031298650 SC35C C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb020022515230 RTx7000 C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb031035326097 PI586430 C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb037049831532 S. propinquum 369-1 C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb043062447840 Zengada (IBC/E-308) C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb007008254758 IS3614-2 C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb019021312990 Rio C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb027030076497 SC326-6 C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb030033472421 SC62C C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb006006942516 ICSV745 C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb008009236881 IS8525 C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb041059865292 Kilo (IBC/E-382) C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb032036336628 B963676 C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb034041275755 S. bicolor (PI226096) C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb004004820566 Greenleaf C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb003003356819 B923296 C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb001000925743 Ai4 C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb036044925001 S. bicolor subsp.verticilliflorum (AusTRCF 317961) C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb011012564890 KS115 C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb010011528201 Karper 669 C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb035042971945 PI585749 C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb038054763749 S. propinquum 369-2 C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb002002433410 BTx642 C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb048066201237 SS79 C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb018020440989 R931945-2-2 C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb025028081351 SC23 C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb039057191876 IBC/E-38432 C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb029032414748 SC56-14E C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb022025024526 SC103-14E C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb013014802332 M35-1 C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb040058532160 Yik. solate (IBC/E-339) C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb026029133186 SC237-14E C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
snp_sb046064772963 Keller C ATGAGGCTCCCACCTGTACATACCACAAGA CCTACAGCCTGAAGAGATATGAAACTATTG 2015-01-01 2015-01-01
6.Fasta Information
AGCAACTGAT CGAACTAAAC ATGAGGCTCC CACCTGTACA TACCACAAGA
C
CCTACAGCCT GAAGAGATAT GAAACTATTG ATTTTACAGT GTAAAGCTTC