SNP Detail For snp_sb017019080426    [See in GBrowse]
1.General Information
SNP ID: snp_sb017019080426
Organism: Sorghum
Individual: QL12
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: W
5'flank: ATACTTTTATGTGTCCAAACTATAGTAAAA
3'flank: TCCATGTGTTCAAGGTATGGTAATATTTTT
3.Reference Map information
Chrom Position Reference QL12
Chr9 10074 T W
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
Sobic.009G000100 267 - W 3' UTR Variant
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb009010319868 IS9710 W ATACTTTTATGTGTCCAAACTATAGTAAAA TCCATGTGTTCAAGGTATGGTAATATTTTT 2015-01-01 2015-01-01
snp_sb016017826097 PI525695 W ATACTTTTATGTGTCCAAACTATAGTAAAA TCCATGTGTTCAAGGTATGGTAATATTTTT 2015-01-01 2015-01-01
snp_sb031035326094 PI586430 W ATACTTTTATGTGTCCAAACTATAGTAAAA TCCATGTGTTCAAGGTATGGTAATATTTTT 2015-01-01 2015-01-01
snp_sb044063640716 PI563516 W ATACTTTTATGTGTCCAAACTATAGTAAAA TCCATGTGTTCAAGGTATGGTAATATTTTT 2015-01-01 2015-01-01
snp_sb035042971943 PI585749 A ATACTTTTATGTGTCCAAACTATAGTAAAA TCCATGTGTTCAAGGTATGGTAATATTTTT 2015-01-01 2015-01-01
snp_sb007008254756 IS3614-2 A ATACTTTTATGTGTCCAAACTATAGTAAAA TCCATGTGTTCAAGGTATGGTAATATTTTT 2015-01-01 2015-01-01
6.Fasta Information
GTAAAATTCT AGACTTTTCC ATACTTTTAT GTGTCCAAAC TATAGTAAAA
W
TCCATGTGTT CAAGGTATGG TAATATTTTT TGTGAAAGCT TGAGGAGGTA