SNP Detail For snp_sb017019080425    [See in GBrowse]
1.General Information
SNP ID: snp_sb017019080425
Organism: Sorghum
Individual: QL12
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: W
5'flank: GGTAAAATTTTAGACTTTTCCATACTTTTA
3'flank: GTGTCCAAACCATAGTAAAATTTCATGTGT
3.Reference Map information
Chrom Position Reference QL12
Chr9 8382 T W
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb044063640714 PI563516 W GGTAAAATTTTAGACTTTTCCATACTTTTA GTGTCCAAACCATAGTAAAATTTCATGTGT 2015-01-01 2015-01-01
snp_sb031035326089 PI586430 W GGTAAAATTTTAGACTTTTCCATACTTTTA GTGTCCAAACCATAGTAAAATTTCATGTGT 2015-01-01 2015-01-01
snp_sb009010319866 IS9710 A GGTAAAATTTTAGACTTTTCCATACTTTTA GTGTCCAAACCATAGTAAAATTTCATGTGT 2015-01-01 2015-01-01
snp_sb007008254755 IS3614-2 A GGTAAAATTTTAGACTTTTCCATACTTTTA GTGTCCAAACCATAGTAAAATTTCATGTGT 2015-01-01 2015-01-01
6.Fasta Information
AGTCTAGGAC TCCAAACCAT GGTAAAATTT TAGACTTTTC CATACTTTTA
W
GTGTCCAAAC CATAGTAAAA TTTCATGTGT GCAAGGTATG GTAATATTTT