SNP Detail For snp_sb017019080421    [See in GBrowse]
1.General Information
SNP ID: snp_sb017019080421
Organism: Sorghum
Individual: QL12
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: G
5'flank: CTATGTGTTCAAAGTGTGGTAATATTTTTT
3'flank: TGAAAGCTTGAGGAGCACTCTATCACAGCT
3.Reference Map information
Chrom Position Reference QL12
Chr9 7515 C G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb004004820557 Greenleaf S CTATGTGTTCAAAGTGTGGTAATATTTTTT TGAAAGCTTGAGGAGCACTCTATCACAGCT 2015-01-01 2015-01-01
snp_sb021024047946 S. bicolor subsp. drummondii (PI330272) S CTATGTGTTCAAAGTGTGGTAATATTTTTT TGAAAGCTTGAGGAGCACTCTATCACAGCT 2015-01-01 2015-01-01
snp_sb027030076494 SC326-6 G CTATGTGTTCAAAGTGTGGTAATATTTTTT TGAAAGCTTGAGGAGCACTCTATCACAGCT 2015-01-01 2015-01-01
snp_sb040058532148 Yik. solate (IBC/E-339) S CTATGTGTTCAAAGTGTGGTAATATTTTTT TGAAAGCTTGAGGAGCACTCTATCACAGCT 2015-01-01 2015-01-01
snp_sb038054763721 S. propinquum 369-2 G CTATGTGTTCAAAGTGTGGTAATATTTTTT TGAAAGCTTGAGGAGCACTCTATCACAGCT 2015-01-01 2015-01-01
snp_sb042060954569 Cherekit (IBC/E-460) S CTATGTGTTCAAAGTGTGGTAATATTTTTT TGAAAGCTTGAGGAGCACTCTATCACAGCT 2015-01-01 2015-01-01
snp_sb011012564882 KS115 S CTATGTGTTCAAAGTGTGGTAATATTTTTT TGAAAGCTTGAGGAGCACTCTATCACAGCT 2015-01-01 2015-01-01
snp_sb023025929510 SC108C S CTATGTGTTCAAAGTGTGGTAATATTTTTT TGAAAGCTTGAGGAGCACTCTATCACAGCT 2015-01-01 2015-01-01
snp_sb006006942503 ICSV745 S CTATGTGTTCAAAGTGTGGTAATATTTTTT TGAAAGCTTGAGGAGCACTCTATCACAGCT 2015-01-01 2015-01-01
snp_sb048066201219 SS79 S CTATGTGTTCAAAGTGTGGTAATATTTTTT TGAAAGCTTGAGGAGCACTCTATCACAGCT 2015-01-01 2015-01-01
snp_sb025028081342 SC23 S CTATGTGTTCAAAGTGTGGTAATATTTTTT TGAAAGCTTGAGGAGCACTCTATCACAGCT 2015-01-01 2015-01-01
snp_sb028031298639 SC35C S CTATGTGTTCAAAGTGTGGTAATATTTTTT TGAAAGCTTGAGGAGCACTCTATCACAGCT 2015-01-01 2015-01-01
snp_sb037049831500 S. propinquum 369-1 S CTATGTGTTCAAAGTGTGGTAATATTTTTT TGAAAGCTTGAGGAGCACTCTATCACAGCT 2015-01-01 2015-01-01
snp_sb041059865288 Kilo (IBC/E-382) G CTATGTGTTCAAAGTGTGGTAATATTTTTT TGAAAGCTTGAGGAGCACTCTATCACAGCT 2015-01-01 2015-01-01
snp_sb029032414738 SC56-14E S CTATGTGTTCAAAGTGTGGTAATATTTTTT TGAAAGCTTGAGGAGCACTCTATCACAGCT 2015-01-01 2015-01-01
snp_sb002002433400 BTx642 S CTATGTGTTCAAAGTGTGGTAATATTTTTT TGAAAGCTTGAGGAGCACTCTATCACAGCT 2015-01-01 2015-01-01
snp_sb019021312987 Rio S CTATGTGTTCAAAGTGTGGTAATATTTTTT TGAAAGCTTGAGGAGCACTCTATCACAGCT 2015-01-01 2015-01-01
6.Fasta Information
GTCCTAACCA TAGTAAAATT CTATGTGTTC AAAGTGTGGT AATATTTTTT
G
TGAAAGCTTG AGGAGCACTC TATCACAGCT CAAGGGACCC TATCACACCT