SNP Detail For snp_sb012012908838    [See in GBrowse]
1.General Information
SNP ID: snp_sb012012908838
Organism: Sorghum
Individual: LR9198
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: A
5'flank: TCAAGCTATATGGCTTTGACTTGACATAGT
3'flank: TACTAGTAGAGTGTAATTTTCTCGATAGGC
3.Reference Map information
Chrom Position Reference LR9198
Chr2 114780 G A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb025027113117 SC23 A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb035041904318 PI585749 A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb006006244184 ICSV745 A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb022024511998 SC103-14E A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb043061336367 Zengada (IBC/E-308) A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb024026164675 SC170-6-8 A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb001000125708 Ai4 A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb010010714354 Karper 669 A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb045064018627 Ji_2731 A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb002001413699 BTx642 A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb019020812837 Rio A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb009009676943 IS9710 A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb008008643293 IS8525 A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb041058959010 Kilo (IBC/E-382) A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb007007283405 IS3614-2 A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb003002939599 B923296 A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb016016390239 PI525695 A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb044062947115 PI563516 A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb031033936232 PI586430 A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb028030441471 SC35C A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb040057742238 Yik. solate (IBC/E-339) A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb027029480819 SC326-6 A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb021022973416 S. bicolor subsp. drummondii (PI330272) A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb038051234549 S. propinquum 369-2 A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb048065423390 SS79 A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb039055985903 IBC/E-38432 A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb014015106204 Macia A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb018019536976 R931945-2-2 A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb017018399843 QL12 A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb032035882399 B963676 R TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
snp_sb037046064641 S. propinquum 369-1 A TCAAGCTATATGGCTTTGACTTGACATAGT TACTAGTAGAGTGTAATTTTCTCGATAGGC 2015-01-01 2015-01-01
6.Fasta Information
CTGGGACATA CAGCACAAAT TCAAGCTATA TGGCTTTGAC TTGACATAGT
A
TACTAGTAGA GTGTAATTTT CTCGATAGGC GTAAGAAAGT AACTTGGATA