SNP Detail For snp_sb012012908835    [See in GBrowse]
1.General Information
SNP ID: snp_sb012012908835
Organism: Sorghum
Individual: LR9198
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: T
5'flank: CTTGCACTCATTTAGCAGAACTTACCACCG
3'flank: TGTGTTAGTGGGATCCCAAGTTGTCCTCGA
3.Reference Map information
Chrom Position Reference LR9198
Chr2 63581 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb035041904315 PI585749 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb025027113114 SC23 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb001000125705 Ai4 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb006006244181 ICSV745 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb043061336364 Zengada (IBC/E-308) T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb010010714350 Karper 669 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb022024511995 SC103-14E T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb038051234496 S. propinquum 369-2 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb034039884724 S. bicolor (PI226096) T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb008008643290 IS8525 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb030032790255 SC62C T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb019020812833 Rio T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb041058959007 Kilo (IBC/E-382) T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb009009676940 IS9710 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb033036799598 S. bicolor subsp. verticilliflorum (PI300119) T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb003002939596 B923296 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb016016390233 PI525695 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb007007283401 IS3614-2 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb018019536972 R931945-2-2 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb031033936227 PI586430 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb044062947112 PI563516 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb002001413695 BTx642 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb040057742235 Yik. solate (IBC/E-339) T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb028030441468 SC35C T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb047064895857 E-Tian T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb024026164670 SC170-6-8 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb027029480816 SC326-6 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb046064550890 Keller T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb037046064589 S. propinquum 369-1 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb004003731905 Greenleaf T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb017018399841 QL12 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb036043507374 S. bicolor subsp.verticilliflorum (AusTRCF 317961) T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb039055985900 IBC/E-38432 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb021022973413 S. bicolor subsp. drummondii (PI330272) T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb011011916491 KS115 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb014015106200 Macia T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb048065423384 SS79 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
snp_sb032035882396 B963676 T CTTGCACTCATTTAGCAGAACTTACCACCG TGTGTTAGTGGGATCCCAAGTTGTCCTCGA 2015-01-01 2015-01-01
6.Fasta Information
AGGATTTAGG GTCATCTTTC CTTGCACTCA TTTAGCAGAA CTTACCACCG
T
TGTGTTAGTG GGATCCCAAG TTGTCCTCGA CCAGCAAATG AAGGCAGCAT