SNP Detail For snp_sb012012908834    [See in GBrowse]
1.General Information
SNP ID: snp_sb012012908834
Organism: Sorghum
Individual: LR9198
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: G
5'flank: TCTACAGTTACATAACTGCTAGAAAAAGTT
3'flank: CCGCTATTTTTAATAGCTGGCTATTTTAAA
3.Reference Map information
Chrom Position Reference LR9198
Chr2 63298 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb025027113113 SC23 G TCTACAGTTACATAACTGCTAGAAAAAGTT CCGCTATTTTTAATAGCTGGCTATTTTAAA 2015-01-01 2015-01-01
snp_sb035041904314 PI585749 G TCTACAGTTACATAACTGCTAGAAAAAGTT CCGCTATTTTTAATAGCTGGCTATTTTAAA 2015-01-01 2015-01-01
snp_sb044062947111 PI563516 G TCTACAGTTACATAACTGCTAGAAAAAGTT CCGCTATTTTTAATAGCTGGCTATTTTAAA 2015-01-01 2015-01-01
snp_sb001000125704 Ai4 G TCTACAGTTACATAACTGCTAGAAAAAGTT CCGCTATTTTTAATAGCTGGCTATTTTAAA 2015-01-01 2015-01-01
snp_sb002001413694 BTx642 G TCTACAGTTACATAACTGCTAGAAAAAGTT CCGCTATTTTTAATAGCTGGCTATTTTAAA 2015-01-01 2015-01-01
snp_sb006006244180 ICSV745 G TCTACAGTTACATAACTGCTAGAAAAAGTT CCGCTATTTTTAATAGCTGGCTATTTTAAA 2015-01-01 2015-01-01
snp_sb028030441467 SC35C G TCTACAGTTACATAACTGCTAGAAAAAGTT CCGCTATTTTTAATAGCTGGCTATTTTAAA 2015-01-01 2015-01-01
snp_sb040057742234 Yik. solate (IBC/E-339) G TCTACAGTTACATAACTGCTAGAAAAAGTT CCGCTATTTTTAATAGCTGGCTATTTTAAA 2015-01-01 2015-01-01
snp_sb022024511994 SC103-14E G TCTACAGTTACATAACTGCTAGAAAAAGTT CCGCTATTTTTAATAGCTGGCTATTTTAAA 2015-01-01 2015-01-01
snp_sb027029480815 SC326-6 G TCTACAGTTACATAACTGCTAGAAAAAGTT CCGCTATTTTTAATAGCTGGCTATTTTAAA 2015-01-01 2015-01-01
snp_sb014015106199 Macia G TCTACAGTTACATAACTGCTAGAAAAAGTT CCGCTATTTTTAATAGCTGGCTATTTTAAA 2015-01-01 2015-01-01
snp_sb046064550889 Keller G TCTACAGTTACATAACTGCTAGAAAAAGTT CCGCTATTTTTAATAGCTGGCTATTTTAAA 2015-01-01 2015-01-01
snp_sb048065423383 SS79 G TCTACAGTTACATAACTGCTAGAAAAAGTT CCGCTATTTTTAATAGCTGGCTATTTTAAA 2015-01-01 2015-01-01
snp_sb009009676939 IS9710 G TCTACAGTTACATAACTGCTAGAAAAAGTT CCGCTATTTTTAATAGCTGGCTATTTTAAA 2015-01-01 2015-01-01
snp_sb017018399840 QL12 G TCTACAGTTACATAACTGCTAGAAAAAGTT CCGCTATTTTTAATAGCTGGCTATTTTAAA 2015-01-01 2015-01-01
snp_sb032035882395 B963676 G TCTACAGTTACATAACTGCTAGAAAAAGTT CCGCTATTTTTAATAGCTGGCTATTTTAAA 2015-01-01 2015-01-01
snp_sb008008643289 IS8525 G TCTACAGTTACATAACTGCTAGAAAAAGTT CCGCTATTTTTAATAGCTGGCTATTTTAAA 2015-01-01 2015-01-01
snp_sb019020812832 Rio G TCTACAGTTACATAACTGCTAGAAAAAGTT CCGCTATTTTTAATAGCTGGCTATTTTAAA 2015-01-01 2015-01-01
snp_sb039055985899 IBC/E-38432 G TCTACAGTTACATAACTGCTAGAAAAAGTT CCGCTATTTTTAATAGCTGGCTATTTTAAA 2015-01-01 2015-01-01
snp_sb041058959006 Kilo (IBC/E-382) G TCTACAGTTACATAACTGCTAGAAAAAGTT CCGCTATTTTTAATAGCTGGCTATTTTAAA 2015-01-01 2015-01-01
6.Fasta Information
ATGTTATCTA TCATAGCGCC TCTACAGTTA CATAACTGCT AGAAAAAGTT
G
CCGCTATTTT TAATAGCTGG CTATTTTAAA CTTTGGATTA TAGGTAAGTT