SNP Detail For snp_sb012012908833    [See in GBrowse]
1.General Information
SNP ID: snp_sb012012908833
Organism: Sorghum
Individual: LR9198
Create time: 2015-01-01
Last update: 2015-01-01
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: SNP
Genotype: G
5'flank: AGCGACTAGCAGGGCAAGGGTCAGCTAGAC
3'flank: TGAGGTGATTCGTGCATATTTTACCCTTTG
3.Reference Map information
Chrom Position Reference LR9198
Chr2 62826 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_sb037046064573 S. propinquum 369-1 G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb025027113112 SC23 G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb001000125703 Ai4 G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb035041904313 PI585749 G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb017018399839 QL12 G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb034039884716 S. bicolor (PI226096) G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb043061336363 Zengada (IBC/E-308) G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb006006244178 ICSV745 G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb010010714349 Karper 669 G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb022024511992 SC103-14E G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb030032790244 SC62C G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb033036799589 S. bicolor subsp. verticilliflorum (PI300119) G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb008008643288 IS8525 G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb041058959005 Kilo (IBC/E-382) G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb018019536971 R931945-2-2 G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb019020812831 Rio G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb031033936224 PI586430 G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb044062947110 PI563516 G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb003002939595 B923296 G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb007007283400 IS3614-2 G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb002001413693 BTx642 G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb040057742233 Yik. solate (IBC/E-339) G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb028030441466 SC35C G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb016016390230 PI525695 G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb027029480814 SC326-6 G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb048065423382 SS79 G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb036043507366 S. bicolor subsp.verticilliflorum (AusTRCF 317961) G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb014015106197 Macia G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb024026164667 SC170-6-8 G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb011011916483 KS115 G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb032035882394 B963676 G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb021022973412 S. bicolor subsp. drummondii (PI330272) G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb038051234486 S. propinquum 369-2 G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
snp_sb039055985898 IBC/E-38432 G AGCGACTAGCAGGGCAAGGGTCAGCTAGAC TGAGGTGATTCGTGCATATTTTACCCTTTG 2015-01-01 2015-01-01
6.Fasta Information
AACTGGTCTG AAATACCACT AGCGACTAGC AGGGCAAGGG TCAGCTAGAC
G
TGAGGTGATT CGTGCATATT TTACCCTTTG CACCCATTAT TGGTGAGATT